• Новости
  • Заметки
  • Картинки
  • Видео
  • Переводы
  • Опергеймер
  • Проекты
  • Магазин

Происхождение Рюриковичей

02.03.13 17:52 | Goblin | 231 комментарий »

История

По заданию Кремля вешаю текст:
В июне 2012 года князья, члены Российского Дворянского собрания, начиная с Г. Гагарина, сдавали свои мазки из ротовой полости для определения ДНК, и что в декабре 2012 года, наконец, результаты были готовы. Там, правда, работы для получения результатов всего на несколько дней, но попгенетики запрягают долго. А главное – я и не знал, что это только в 2012 году определят, когда в начале 2011 года анализировал гаплотипы этих же князей по базам данных (статья об этом в Вестнике ДНК-генеалогии вышла в апреле того же 2011 года). Зачем нужно было комедию в фильме ломать, когда у того же князя Гагарина гаплотип давно уже был определен, а именно в конце 2007 года, как и то, что среди «Рюриковичей» есть две линии, R1a и N1c1. Это давно известно.

Но самое комичное в фильме было в конце. Это когда три танкиста, три веселых друга… пардон, три попгенетика собрались вместе в декабре 2012 года, и крупно писали друг другу на листе бумаги те самые буквы – R1a и N1c1, которые фигурировали в статье «Операция “чистые Рюрики”» в русском издании журнала Newsweek в далеком 2007 году. И когда В. Волков ткнул пальцем в буквы N1c1 и сказал – «жил в Швеции». Откуда, каким это образом? А так… потому что так нужно было. Норманизм.
Происхождение Рюриковичей: ДНК-генеалогия доказывает

Вконтакте
Одноклассники
Google+

Комментарии


cтраницы: 1 | 2 | 3 всего: 231, Goblin: 6

Цитата
отправлено 02.03.13 17:53 # 1


В самом конце прошлого года в эфире появился фильм «Русь. Зарождение государственности. Идентификация Рюрика», который, по всей видимости, должен был составить «конкуренцию» авторскому фильму Михаила Задорнова «Рюрик. Потерянная быль», сразу побившему все рекорды по просмотрам. Вопрос был поставлен всё тот же – кем был Рюрик на самом деле?



Этот фильм я посмотрел. Он состоит, по сути, из двух частей, перемежающихся одна с другой. Первая часть – вполне познавательная, о похищении костей Ярослава Мудрого из Киева и предположительном перевозе их в Нью-Йорк в 1940-х годах. Вторая часть – совершенно примитивная, и я бы сказал, что полная профанация – о якобы ДНК-генеалогии. Персонажи в ней – под стать. Это В. Волков, музейный сотрудник из Томска, якобы «ДНК-генеалог», хотя в ДНК-генеалогии он персонаж совершенно случайный. Наберитесь терпения, уважаемый читатель, я вскоре об этом расскажу. Затем популяционный генетик О. Балановский, который довольно предусмотрительно сыграл в фильме роль статиста, и ничего содержательного не высказал. О его творчестве я уже рассказывал – это автор той самой «научной» профанации, что украинские славяне якобы совсем другие, чем белорусские и, тем более, русские, и ближе других к полякам. В общем, паноптикум еще тот.


Я не знаю, кто из этих «ДНК-генеалогов» консультировал фильм, но за фразу, прозвучавшую в самом начале, что «каждый этнос имеет свою гаплогруппу», надо выгонять без выходного пособия. Этносы – это практически всегда объединения разных гаплогрупп. Нет у них «своей гаплогруппы». Например, в русском этносе есть четыре основных гаплогруппы – R1a, I1, I2, и N1c1, плюс еще десяток минорных, которых среди русских от нескольких процентов до долей процента. Что они – не русский этнос?

Комедийный тон фильму задала некая Елена Мельникова, которая сообщила, что имя Рюрик – шведское, и произошло от имени Хрерикер. Да, есть такое – пишется как Hrœrekr, но при чем здесь Рюрик? Надо было сразу врезать зрителям, что это имя произошло от Рериха, Николая Константиновича. Было бы более убедительно.

Забавно было и то, как в фильме показано, что в июне 2012 года князья, члены Российского Дворянского собрания, начиная с Г. Гагарина, сдавали свои мазки из ротовой полости для определения ДНК, и что в декабре 2012 года, наконец, результаты были готовы. Там, правда, работы для получения результатов всего на несколько дней, но попгенетики запрягают долго. А главное – я и не знал, что это только в 2012 году определят, когда в начале 2011 года анализировал гаплотипы этих же князей по базам данных (статья об этом в Вестнике ДНК-генеалогии вышла в апреле того же 2011 года). Зачем нужно было комедию в фильме ломать, когда у того же князя Гагарина гаплотип давно уже был определен, а именно в конце 2007 года, как и то, что среди «Рюриковичей» есть две линии, R1a и N1c1. Это давно известно.

Но самое комичное в фильме было в конце. Это когда три танкиста, три веселых друга… пардон, три попгенетика собрались вместе в декабре 2012 года, и крупно писали друг другу на листе бумаги те самые буквы – R1a и N1c1, которые фигурировали в статье «Операция “чистые Рюрики”» в русском издании журнала Newsweek в далеком 2007 году. И когда В. Волков ткнул пальцем в буквы N1c1 и сказал – «жил в Швеции». Откуда, каким это образом? А так… потому что так нужно было. Норманизм.

В упомянутой статье в Newsweek было написано: «Норманистам, с XVIII в. твердящим о скандинавских корнях варяга, конечно, придется по душе угро-финнская версия». И дальше – «Генетики согласны, что ДНК Мономашичей скорее указывают на их скандинавское происхождение. «Результаты анализов Шаховского, Гагарина и Лобанова-Ростовского свидетельствуют, что они были скорее скандинавами, чем балтами. Судя по популяционному распределению их гаплотипа, он частенько присутствует на севере Норвегии, в Швеции, Финляндии и Эстонии; и только один случай на многочисленную выборку у поляков, при этом ни одного случая у балтов», – сказал Newsweek завлабораторией генетики Института биологических проблем Севера Борис Малярчук. Наш поиск по крупнейшей онлайновой базе YSearch подтвердил его слова: среди найденных там нескольких десятков генетических родственников Рюриковичей 90% заявили, что их дальние предки жили в центре и на севере современной Финляндии, а оставшиеся 10% указали Швецию и Британию».

Я не знаю, кого они искали и с кем они говорили, и кто такие «генетические родственники Рюриковичей», да еще «несколько десятков», только здесь практически каждое слово – неправда.

Уже после выхода фильма Михаила Задорнова в эфир, в программе Павла Лобкова прошло интервью с неким Владимиром Волковым из Томска. Он почему-то представился «генетиком» и «ДНК-генеалогом», хотя ни тем и ни другим не является. Уже в начале передачи Волков заявил, что гаплотипы Рюриковичей – «шведские». Стало ясно, что к ДНК-генеалогии Волков имеет минимальное отношение, потому что «шведских гаплотипов» просто не бывает, во всяком случае гаплотипов группы N1c1. Во-первых, гаплотипов группы N1c1 в Швеции совсем мало, и, во-вторых, они или финские (с характерной «подписью»), которых тоже мало, или славянские по происхождению (с другой характерной «подписью»), которых больше.

Итак, имеем откровенную дезинформацию от журнала Newsweek (правда, под вывеской «генетики согласны»), что якобы:


• Рюриковичи имеют скандинавское происхождение;
• Что Рюриковичи имеют «финно-угорское» происхождение;
• Что они «были скорее скандинавами, чем балтами»;
• Что «судя по популяционному распределению их гаплотипа, он частенько присутствует на севере Норвегии, в Швеции, Финляндии и Эстонии; и только один случай на многочисленную выборку у поляков, при этом ни одного случая у балтов» – по словам завлабораторией генетики Института биологических проблем Севера Бориса Малярчука;
• Что среди найденных нескольких десятков генетических родственников Рюриковичей 90% заявили, что их дальние предки жили в центре и на севере современной Финляндии, а оставшиеся 10% указали Швецию и Британию.


То, что якобы «родственники» такое заявили – это, конечно, может быть, но откуда эти «несколько десятков генетических родственников» появились, и как это проверялось, что они действительно «генетические родственники»? И почему именно Рюриковичей? Давайте этим и займемся.

Для этого нам понадобится объяснить три понятия – гаплогруппа, гаплотип, и дерево гаплотипов. Далее, объяснить, как ведутся расчеты, и какого типа выводы из этих расчетов делаются. Объяснять будем «на натуре», так понятнее, чем сухая теория.

Гаплогруппа – это род человека (в данном случае). Рода-гаплогруппы обозначаются индексами. Всего у современного человечества, у его мужской части, 20 основных гаплогрупп, их обозначают по буквам латинского алфавита от А до Т. В отношении возможных Рюриковичей нас будут интересовать две гаплогруппы – N и R, точнее, их более недавние ответвления, R1a и N1c1. Это как бы молодые побеги на старом дереве. Сами гаплогруппы N и R образовались примерно 20 и 30 тысяч лет назад соответственно, причем это образование было многоступенчатым, путем мутаций, спонтанно возникающих в Y-хромосоме ДНК у гаплогрупп-предшественников.

В ходе миграции из Алтайского региона (который оказался колыбелью значительной части человечества, или если не колыбелью, то детским садом) на север, на Урал, гаплогруппа N в своем мутационном развитии образовала подгруппу, субклад, ветвь (все термины в ходу) N1, затем N1c, затем N1c1. В истории этой миграции много остается неясным, особенно в ее начальном периоде, но в настоящее время складывается, что миграция через Сибирь началась примерно 8 тысяч лет назад, гаплогруппа N1c образовалась примерно 6 тысяч лет назад, и гаплогруппа N1c1 двигалась с Урала на Балтику примерно 4 тысячи лет назад. Эту гаплогруппу можно условно назвать уральской. Можно было бы обратиться к лингвистике, чтобы объединиться с ней в названиях, но, к сожалению, далее на запад и юг от уральской группы языков лингвисты в своей безграничной мудрости постоянно вставляют в языки слово «финские», «финно-угорские», «финно-пермские», «финно-волжские», «прибалтийско-финские». Как мы ниже увидим, это не согласуется с картиной миграций народов, родов, гаплогрупп. Эти миграции шли разными группами – будущие финны отдельно, будущие южные балты – отдельно. Они – не финны по происхождению, по генеалогии.

Что мы увидим – так это то, что на своем пути с Урала гаплогруппа N1c1 разошлась на два потока, один направился на территорию современной Финляндии, прибыл примерно 2000-1500 лет назад, и имеет полное право называться финским, другой – в сторону Южной Балтики (современные этнические русские, литовцы, поляки), прибыл раньше, примерно 2500-2000 лет назад. Это – южные балты, и вовсе не финны. Гаплогруппа многих там N1c1, но мы знаем, что ни поляки, ни литовцы на «финских» языках не говорят. Их гаплотипы в основном принципиально другие, чем у финнов. Это по происхождению другая группа людей.

Короче, постепенно подходя к сути нашего повествования, вокруг восточной Прибалтики живут два народа, финны и южные балты, каждый со своим набором гаплотипов, да и гаплогрупп. Дело в том, что если уходить глубже в гаплогруппу N1c1, то у финнов в основном так и остается N1c1, а у южных балтов появляется N1c1-L550. Это означает, что более северный миграционный поток донес свою гаплогруппу N1c1 до территории современной Финляндии, а в более южном потоке и несколько более древнем, южно-балтийском, у кого-то из отцов-основателей проскочила мутация L550, в потомках закрепилась, и именно эти потомки в основном выжили среди южных балтов гаплогруппы N1c1.

Вот такая лотерея, в которую природа играет, не переставая. Естественно, к южным балтам могли примкнуть и те, кто сохранил исходную гаплогруппу N1c1, без L550, и тем не менее стал частью южных балтов. А какое-то количество тех, кто получил L550, могли уйти с финнами, или переселиться к ним позже, например, во времена Российской империи, в которую Финляндия входила на протяжении более ста лет (1809-1917), а до того финнами семь веков правили шведы. Переселяются из России в Финляндию и сейчас. Поэтому надо понимать, что ДНК-генеалогические признаки не являются абсолютными (как, впрочем, и никакие другие), но они, будучи вероятностными, помогают приходить к определенным выводам, особенно когда подкрепляются положениями археологии, антропологии, лингвистики, которые, естественно, тоже не являются абсолютными. Так происходит постепенное приближение «к истине», которая тоже не абсолютна, потому что в постоянном приближении. Так работает наука.

Сейчас мы увидим, как эти приближения позволяют выстраивать концепцию относительно «Рюриковичей».

Итак, с гаплогруппами мы разобрались. Так вот, «Рюриковичи», а именно князья, члены Российского Дворянского Собрания которые себя считают Рюриковичами, на самом деле имеют две основные гаплогруппы – R1a и N1c1. «Критики», провозглашающие «шведские» гаплогруппы или гаплотипы, об этом почему-то умалчивают. Тот же Волков, выставляющий себя за «ДНК-генеалога» и за «специалиста по Рюриковичам», об этом ни слова не сказал.

Кто имеет гаплогруппу R1a? Наиболее серьезные кандидаты на «Рюриковичей» – группа из четырех человек – князь Оболенский, князь Волконский, Пентекост/Волконский, князь Барятинский. Их гаплотипы следующие:

12 25 17 10 10 14 12 12 11 13 11 17 – 16 9 10 11 11 23 14 21 33 12 15 15 16 –
12 11 19 23 17 16 18 19 34 41 14 11

13 25 15 10 10 14 12 12 11 13 11 17 – 15 9 10 11 11 23 14 21 32 12 15 15 16 –
11 11 19 23 17 16 18 19 35 40 14 11

13 25 17 10 10 14 12 12 11 13 11 16 – 16 9 10 11 11 23 14 21 33 12 15 15 16 –
11 11 19 23 17 16 18 19 35 39 14 11

13 25 17 10 10 14 12 12 11 13 11 17 – 16 9 10 11 11 23 14 21 32 12 15 15 16 –
11 11 19 23 16 16 18 19 34 41 14 11

Гаплотипы – это совокупность фрагментов в ДНК, выбранные для ДНК-генеалогического анализа. Выше – четыре 37-маркерных гаплотипа. Каждый маркер, или локус – это определенный фрагмент, участок Y-хромосомы (в данном случае), содержащий повторяющиеся последовательности нуклеотидов. Например, в первом локусе у троих «Рюриковичей» одна и та же четверка нуклеотидов (AGAT) повторяется в ДНК 13 раз:

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC

а у одного – 12 раз:

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC

Это означает, что копирующий фермент дал сбой, скопировал четверку AGAT на один повтор меньше, и этот сбой пойдет, наследуясь, уже по линии потомков, до следующего сбоя. Сбой именно в этом локусе происходит в среднем раз в 1316 поколений (то есть раз в 1316 копированиях), или примерно раз в 33 тысячи лет. Можно перефразировать – такая мутация случается в среднем один раз на 1316 рождений мальчиков. Все эти мутации неупорядоченные и непредсказуемые, никто не знает и нельзя рассчитать, у кого следующего произойдет.

Еще более медленный маркер в гаплотипах – седьмой по счету от начала, он у всех четырех «Рюриковичей» в этом локусе повторяется 12 раз. Это уже тройка нуклеотидов GTT:

CTCAAAGTATGAAAGCATGACCACTTCATTTATTGT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GACACAAAGTCTCGTCTTGTCACC

Не удивительно, что у всех четверых число повторов одинаково. Сбой именно в этом локусе происходит в среднем раз в 11100 поколений (то есть раз в 11100 копированиях), или примерно раз в 280 тысяч лет. Или, как пояснено выше – такая мутация случается в среднем один раз на 11100 рождений мальчиков.

Во втором по порядку локусов у всех приведенных здесь «Рюриковичей» этот «тандемный повтор» произошел 25 раз, и так далее. Жирным шрифтом в гаплотипах отмечены мутации, их среди данных четырех «Рюриковичей» – 14. Но мы знаем, из многих сотен и тысяч экспериментов, что по всех 37 локусах мутации происходят в среднем со скоростью 0.09 мутаций на весь гаплотип на поколение, то есть раз в 11 поколений, или раз в 280 лет. Вот и набежали 14 мутаций со времени жизни общего предка этих четырех человек. Отсюда можно рассчитать, когда он жил: 14/4/0.09 = 39 поколений назад, с небольшой поправкой на возвратные мутации (природу которых здесь обсуждать не будем) – 41 поколение назад, то есть 41х25 = 1025 лет назад. Это – (2012-1025) = примерно 987-й год, но с погрешностью, рассчитанной по определенным правилам – это год 987±290 от начала нашей эры. 25 лет на поколение – это калиброванная величина для скорости мутации 0.09, показанной выше. Для 30 лет на поколение скорость мутации была бы равна 0.108 мутаций на гаплотип на поколение, для 20 лет на поколение – 0.072 мутаций на гаплотип на поколение. Какое бы мы число лет на поколение ни брали, все равно получится приведенная выше величина 1025 лет назад, потому что тогда надо соответственно (пропорционально) менять константу скорости мутации.

Итак, время жизни общего предка четырех «Рюриковичей» гаплогруппы R1a – год 987±290 от рождества Христова. А когда по преданиям жил легендарный Рюрик? Пожалуйста, умер в 879 году, но и это предположительно. Вполне не противоречит. Так откуда с такой уверенностью, выдающей блефующего мошенника, «историки утверждают» и «генетики согласны», что «гаплотип шведский», что Рюрик был то ли шведом, то ли немцем, то ли норвежцем, то ли финном?

Ну ладно, с историками ясно – просто очень хотелось выдать за скандинава, по какой-то странной причине. Но откуда «генетики согласны»? Какие такие генетики? На каком основании «согласны»? В связи с этим показательна фраза из российского издания Newsweek: «Норманистам… конечно, придется по душе угро-финнская версия»… Что у них за душа такая интересная?

Приведенные выше данные и расчеты просто так отвергнуть нельзя. Для этого нужны другие данные и/или другие расчеты, самостоятельно разработанные, а вот с этим будет посложнее. Ни «историки», ни «генетики» этого не умеют. Дурачить просто так они могут, а вот когда доходит до науки, там они пасуют.

Пошли дальше. Откуда наша фраза «Наиболее серьезные кандидаты на «Рюриковичей» – группа из четырех человек – князь Оболенский, князь Волконский, Пентекост/Волконский, князь Барятинский»? Ответ – да из дерева гаплотипов (рис. 1). Эти четыре человека, точнее, их гаплотипы, составляют верхнюю правую ветвь на дереве (гаплотипы 1, 2, 6, 7). Остальные четыре гаплотипа, принадлежащие князю Шуйскому (гаплотип 3), князю Белозерскому (гаплотип 5), князю Друцкому-Соколинскому (гаплотип 8), и гражданину Карпову (гаплотип 4) на Рюриковичей претендовать, увы, не могут. Мутации в их гаплотипах скачут как зайцы, там 53 мутации на четыре гаплотипа. Это помещает их общего предка на 53/4/0.09 = 147 → 172 поколения, или 4300 лет назад. Не Рюриковичи эти князья, и совершенно не родственники первой четверке Рюриковичей – ни один из них. Их общий предок жил на заре прибытия праславян на Русскую равнину, когда Рюриковичей и в проекте не было.


Рис. 1. Дерево 37-маркерных гаплотипов 8 человек гаплогруппы R1a, по одной из версий принадлежащих «потомкам Рюрика». 1 – князь Оболенский, 2 – князь Волконский, 3 – князь Шуйский, 4 – Карпов, 5 – князь Белозерский, 6 – Пентекост/Волконский, 7 – князь Барятинский, 8 – князь Друцкой-Соколинский. Видно, что гаплотипы относятся к нескольким линиям, причем гаплотипы 3, 4, 5 и 8 к совершенно удаленным. Четыре гаплотипа в верхней части дерева (Оболенский, Волконский, Пентекост/Волконский и Барятинский) имеют общего предка, который жил 1025±290 лет назад.

Но и эти данные не позволяют безоговорочно считать четверых «Рюриковичей» гаплогруппы R1a истинными Рюриковичами. Во-первых, на гаплотипах слово «Рюрик» не написано. Их предком, несомненно, был знатный воевода, может, его звали Рюрик, а может – нет. Эти данные важны в основном потому, что показывают, как жульничают «генетики», полуправдой оперируют, а попуправды, как и осетрины второй свежести, не бывает. Значит – ложь. И еще важны эти данные потому, что позволяют выставить рамки исторического анализа, отделить возможные варианты от практически невозможных.

Во-вторых, есть еще причина рассматривать «Рюриковичей» гаплогруппы R1a как вариант, как альтернативу. Это то, что есть еще группа князей, в большинстве членов Российского Дворянского собрания, но уже гаплогруппы N1c1. Вот дерево гаплотипов, на котором князья занимают нижнюю левую ветвь (рис. 2):


Рис. 2. Дерево 67-маркерных гаплотипов 22 человек гаплогруппы N1c1, которые претендуют быть Рюриковичами. Видно, что гаплотипы относятся, по меньшей мере, к четырем линиям, общий предок которых жил примерно 3200 лет назад. Шесть гаплотипов внизу слева (Гагарин, Кропоткин, Хилков, Пузына, Путятин, Вадбольский) имеют общего предка, который жил 1125±230 лет назад (примерно 887±230 год н.э.; семь гаплотипов справа внизу – примерно 2325 лет назад (прошлая эра). Четыре гаплотипа справа вверху (плоская ветвь), предположительно «Гедиминовичи», общий предок жил 520±170 лет назад, XV век плюс-минус один-два века, но они на тысячелетия отличаются от ветви из шести гаплотипов слева. В историческом смысле «Гедиминовичи» – не родственники «Рюриковичам», их общий предок жил примерно 3035 лет назад, во II тыс. до н.э.

Князей – шесть человек: Гагарин, Кропоткин, Хилков, Пузына, Путятин, Вадбольский. Это те, кто имеют протестированные 67-маркерные гаплотипы, которые наиболее чувствительны к вариациям. А поскольку их уже шесть человек, да на каждого 67 маркеров, то на всех уже 402 маркера. Напомню, что в серии R1a маркеров было 4×37 = 148 маркеров. Это не влияет особенно на результат, но влияет на величину погрешности расчетов.

Теперь настало время ввести понятие базового гаплотипа. По сути – это гаплотип общего предка, в данном случае всех шести человек. Называть его именно «предковым» в общем случае рискованно, так как он расчетный. Остальные гаплотипы расходятся от него как круги по воде от брошенного камня. И как можно при умении по кругам рассчитать, куда именно был брошен камень и когда он был брошен (для этого надо знать скорость распространения кругов по воде), так же при умении можно рассчитать, когда жил общий предок, зная константу скорости мутации гаплотипов. Как именно – это уже было показано чуть выше.

Так вот, базовый, то есть предковый гаплотип для указанных шести «Рюриковичей» в данном случае определяется надежно. Он – следующий:

14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

А вот и сами 67-маркерные гаплотипы этих шести князей:

Gag 14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 29 14 15 15 15 – 12 11 18 20 14 15 16 18 34 34 14 10 – 11 8 15 18 8 8 10 8 11 10 12 22 22 14 10 12 12 18 7 12 21 21 15 12 11 10 11 11 12 11

Kro 14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 24 14 19 28 14 14 15 15 – 12 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 19 7 13 21 21 16 12 11 10 11 11 12 11

Khi 14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 29 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

Puz 14 23 14 10 11 13 11 12 11 13 14 16 – 18 9 9 11 12 25 14 19 28 14 14 14 14 – 11 11 18 20 14 15 16 19 34 34 15 9 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

Put 14 23 14 11 11 13 11 12 10 14 14 17 – 18 9 9 11 12 25 14 19 30 14 14 15 15 – 11 10 18 20 14 14 15 19 34 35 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 17 7 13 21 21 16 12 11 10 11 11 12 11

Vad 14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 27 14 14 15 15 – 11 11 18 20 14 15 16 19 34 35 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 17 7 13 21 21 16 12 11 10 11 11 12 11

Все 6 человек отличаются по своим гаплотипам от приведенного базового на 31 мутацию, что дает 31/6/0.12 = 43 → 45 условных поколений (по 25 лет каждое) назад, или 1125±230 лет от их общего предка. Это – примерно 887±230 год. Как видно, это не противоречит годам жизни Рюрика (умер в 879 году) или его именитого современника. На самом деле совпадение здесь практически абсолютное, но не будем на этом фокусироваться, расчетная погрешность не позволяет.

Теперь из педагогических соображений поделюсь маленькой хитростью. Те шесть гаплотипов князей, как и остальные 16 гаплотипов на дереве на рис. 2, были мной описаны и проанализированы в Вестнике Академии ДНК-генеалогии в феврале 2011 года и в сентябре 2012 года. С того времени добавились еще пять 67-маркерных гаплотипов князей гаплогруппы N1c1 – Шаховского, Массальского, Ржевского, Лобанова-Ростовского, Корибут-Воронецкого. Но хитрость не в этом, а в том, что я рассмотрел в настоящей статье оба варианта – предыдущий, с шестью князьями, и последний, с одиннадцатью. Сделал я это для того, чтобы отмести обычные соображения тех, кто в этом не слишком понимают, и тут же заводят разговор, что «выборка мала, данные недостоверны». Вот давайте и посмотрим, как изменится картина и расчеты при переходе от 6 к 11 князьям гаплогруппы N1c1. Новое, увеличенное дерево гаплотипов приведено на рис. 3.


Рис. 3. Дерево 67-маркерных гаплотипов 27 человек гаплогруппы N1c1, которые претендуют быть Рюриковичами. Видно, что гаплотипы относятся, по меньшей мере, к четырем линиям, общий предок которых жил примерно 3200 лет назад. Шесть гаплотипов в нижней части дерева (Гагарин, Кропоткин, Хилков, Пузына, Путятин, Вадбольский, плюс добавленные гаплотипы Шаховского, Ржевского, Массальского, Лобанова-Ростовского и Корибут-Воронецкого) имеют общего предка, который жил 1150±190 лет назад (примерно 862±190 год н.э.). Восемь гаплотипов справа вверху имеют общего предка более двух тысяч лет назад, в середине прошлой эры, к Рюриковичам никакого отношения не имеют (это – некто Кубарев со своей «командой», которую подобрал по сходству гаплотипов со своим, и который бурно претендует на линию «Рюриковича», объявил себя «Великим Князем», «членом Российского Императорского дома», и судится с российским правительством за право на обладание всеми кремлями Российской Федерации, начиная с Московского Кремля – впрочем, юродивых на Руси всегда хватало). Четыре гаплотипа слева (плоская ветвь), предположительно «Гедиминовичи», общий предок жил 520±170 лет назад (см. подпись к рис. 1).

Добавленные пять 67-маркерных гаплотипов следующие:

Sha 14 23 14 11 11 13 11 12 10 14 14 17 – 18 9 9 11 12 25 14 20 28 14 14 15 15 – 12 11 18 20 14 15 17 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 19 7 13 21 21 16 12 11 10 11 11 12 11

Mas 14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 15 19 34 34 15 10 – 11 8 15 18 8 8 10 8 12 10 12 20 22 14 10 12 12 20 7 13 21 21 16 12 11 10 11 11 12 11

Rzh 14 23 14 11 11 13 11 12 10 14 14 17 – 18 9 9 10 12 25 14 19 29 14 14 15 15 – 12 11 18 20 14 15 16 19 34 34 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

Lob 14 23 14 11 12 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 27 14 14 15 15 – 12 11 18 20 14 15 16 18 35 35 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 17 7 13 21 21 16 12 11 10 11 11 12 11

Kor 14 23 14 11 11 13 11 12 10 13 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 17 7 13 21 21 15 12 12 10 11 11 12 11

Как нетрудно убедиться, они имеют тот же самый базовый (предковый) гаплотип, приведенный выше:

14 23 14 11 11 13 11 12 10 14 14 16 – 18 9 9 11 12 25 14 19 28 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 15 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

Это и понятно почему – мутаций так (относительно) мало, что все гаплотипы группируются вокруг предкового гаплотипа.

Все 5 человек отличаются по своим гаплотипам от приведенного базового на 27 мутаций, что в сумме с предыдущими 31 дает 58 мутаций на 11 гаплотипов, то есть 58/11/0.12 = 44 → 46 условных поколений (по 25 лет каждое) назад, или 1150±190 лет от их общего предка. Это – примерно 862±190 год нашей эры. Как видно, это практически та же дата (887±230 год), полученная ранее. Напомним, что Рюрик умер предположительно в 879 году.

В этом и состоит замечательная особенность ДНК-генеалогии. Если гаплотипы неупорядоченно выбирались из одной популяции, с одним общим предком (а состав князей здесь именно неупорядоченный), то результат почти не зависит от размера выборки. Что зависит – так это погрешность расчетов. Но она умышленно завышена, и не может в принципе быть лучше ±10%, так заложено в расчет. Причина этого проста – мы не хотим создавать ложную иллюзию точности расчетов, потому что порой и популяция на самом деле смешанная (то есть в выборку попали гаплотипы другой ДНК-генеалогической линии), и гаплотипов на самом деле мало. Лучше точность показывать «с резервом», чем ее преувеличивать.

Итак, мы видим, что как гаплогруппа R1a, так и N1c1, вписываются по общим предкам «Рюриковичей» в обе группы князей, членов Российского Дворянского собрания. Но кто такие N1c1? Это что, в самом деле, шведы, финны или датчане? Да ничего подобного! Давайте разберемся.

Как уже упоминалось выше, гаплогруппа N1c1 разошлась в итоге своей миграции на Балтику на две линии, одна финская и одна южно-балтийская, которая есть славянская, русская (на территории России), или польская, или литовская, или латышская. Давайте посмотрим на эти гаплотипы. У них есть два характерных различия. У южных балтов, по сути славян, в гаплотипе есть пара 9-9, и четверка 14-14-15-15. ДНК-генеалог скажет, что это в локусах DYS459a,b и DYS464a,b,c,d, соответственно. Вот они, выделены в предковом гаплотипе русских князей гаплогруппы N1c1:

14 23 14 11 11 13 11 12 10 14 14 30 – 18 9 9 11 12 25 14 19 29 14 14 15 15 – 11 11 18 20 14 15 16 19 34 34 14 10 – 11 8 15 18 8 8 10 8 11 10 12 20 22 14 10 12 12 18 7 13 21 21 16 12 11 10 11 11 12 11

У финнов там в основном 10-10, и 13-13-14-14. Это – очень заметные различия. Для того, чтобы эти независимые друг от друга мутации произошли, требуется в среднем около двух тысяч лет.

Давайте отбросим все остальные повторы (так называемые аллели), и построим дерево гаплотипов только для этих двоек и четверок, в совокупности. Для построения дерева 6-маркерных гаплотипов привлечем несколько сотен гаплотипов N1c1 из доступных баз данных. Вот что получилось:


Рис. 4. Дерево гаплотипов 425 человек гаплогруппы N1c1, выявленные по базам данных. Гаплотипы составлены из двоек DYS459 и четверок DYS464. Справа по кругу – в основном славяне (базовый гаплотип 9-9-14-14-15-15), слева на удаленной ветви – в основном финны (базовый гаплотип 10-10-13-13-14-14). Гаплотипы справа по кругу (в основном славяне) принадлежат к субкладу N1c1-L550, гаплотипы слева на удаленной ветви (в основном финны) к этому субкладу не относятся. Все 11 русских князей гаплогруппы N1c1 принадлежат правой ветви, в основном славянской. Важность этого положения объясняется ниже, на схеме субкладов гаплогруппы N.

Итак, слева – финны. Базовая шестерка: 10-10, 13-13-14-14. Имена – Korhonen, Pennainen, Mottonen, Hirvonen, Raisanen, Pohjalainen, Nyyssonen, Hakkarainen, Haikonen, Heikkinen, Lehmoinen, Randalainen, Suikkanen, Vihavainen, Kosunen, Vetelainen, Kemilainen, Toivanen, Wayrynen, Komonen, Keskinen, Leppanen, Mikkonen, Kinnunen, Pyykonen, Rahkonen, Parkulain, Kouko, Heikinpoika, Matinpoika, Marponpoika, Fransinpoika, и подобные.

Справа – в основном славяне, базовая шестерка: 9-9, 14-14-15-15. Имена – Селиванов, Козлов, Свистунов, Данилович, Архипов, Муковников, Потураев, Ларионов, Шеховцов, Кулешов, Забелин, Назаров, Никитин, Васильев, Матюшонок, Прокопович, и так далее. Здесь в основном русские, украинцы, белорусы, поляки. Здесь же латыши – Аузинс, Ласианис, Витавскис; литовцы – Багдонавичус, Семенас, Довыденас, Андреас, Станкевичус, Сабис, Бартайтис, Грусаускас и подобные имена; поляки – Хилинский, Крузиковский, Новак, Орловский, Крупиенский, Буйновский, Клобуковский, Мосжинский, Пиотровский, Рыкацевский, Жуковский, и так далее. Это все правая ветвь на дереве на рис. 4. Напомню, что у них всех шестерка аллелей 9-9, 14-14-15-15. Славяне, во всяком случае, по происхождению.

Смотрим на шестерку аллелей в гаплотипах князей-Рюриковичей. Та же шестерка (редко – с одной мутацией, от чего никто не застрахован):


Гагарин 9-9, 14-15-15-15
Кропоткин 9-9, 14-14-15-15
Хилков 9-9, 14-14-15-15
Пузына 9-9, 14-14-14-14
Путятин 9-9, 14-14-15-15
Вадбольский 9-9, 14-14-15-15
Шаховской 9-9, 14-14-15-15
Массальский 9-9, 14-14-15-15
Ржевский 9-9, 14-14-15-15
Лобанов 9-9, 14-14-15-15
Корибут 9-9, 14-14-15-15


Ну, и где там финны? Нет их там. Это – южные балты, славяне. У Гагарина и Пузыны – одноразовые мутации от предкового гаплотипа. У Пузыны одношаговая мутация 14-14-15-15 → 14-14-14-14, так называемая палиндромная, или мультикопийная. Совершенно обычное дело.

Теперь мы видим цену вот этого: «Генетики согласны, что ДНК Мономашичей скорее указывают на их скандинавское происхождение». Это – либо ложь, либо элементарная неграмотность.

И это – «Результаты анализов Шаховского, Гагарина и Лобанова-Ростовского свидетельствуют, что они были скорее скандинавами, чем балтами» – тоже ложь! Все три гаплотипа приведены выше, это южно-балтийский, славянский гаплотип. Ничего «скандинавского» в нем нет. В каком таком контр-славянском угаре «генетики» отнесли их к скандинавам?

И это – «Судя по популяционному распределению их гаплотипа (то есть князей гаплогруппы N1c1, перечисленных выше – AAK), он частенько присутствует на севере Норвегии, в Швеции, Финляндии и Эстонии; и только один случай на многочисленную выборку у поляков, при этом ни одного случая у балтов», – сказал Newsweek завлабораторией генетики Института биологических проблем Севера Борис Малярчук» – опять-таки ложь!

Вот гаплотипы поляков, которые «только один случай на многочисленную выборку», по словам «завлабораторией генетики». Из 425 гаплотипов группы N1c1 32 принадлежат полякам (у русских – 77 гаплотипов). Из этих 32 польских гаплотипов у 24 гаплотипов (75%) шестерка именно такая: 9-9, 14-14-15-15, то есть это сугубо славянские, южно-балтийские гаплотипы. Еще у четырех – однократная палиндромная мутация 10-10, 14-14-15-15, гаплотип славянский. Еще три польских гаплотипа – опять славянские, с другой палиндромной мутацией: 9-9, 15-15-15-15. Последний – опять славянский, еще с одной палиндромной мутацией – 9,9, 13-13-15-15, но пара девяток указывает на славянский, южно-балтийский вариант. То есть все 32 польских гаплотипа – славянские.

Так что слова «он частенько присутствует… в Финляндии» – опять или ложь, или безграмотность (в лучшем случае – заблуждение) «заведующего лабораторией». Мы уже в этом убедились. Можно, впрочем, дать более мягкий вердикт – «поторопился с выводами». Как только что мне написали его коллеги, у доктора наук Б. Малярчука были в распоряжении только коротенькие гаплотипы, в которых этих характерных особенностей не было. Так тогда зачем было делать ложные выводы? Почему не сказать честно, что данные далеко не однозначные? Зачем было безосновательно гнуть в «норманнскую» сторону? Впрочем, это совершенно типично для популяционных генетиков.

Посмотрим на норвежские, шведские, эстонские гаплотипы. Среди 425 гаплотипов N1c1 их соответственно 10, 21, 3 гаплотипа, и еще 2 датских. Негусто. Обычно столь малое количество гаплотипов характерно для «туристов», которые еще не успели дать достаточно обильное потомство. И это понятно – носители гаплогруппы N1c1 продвигались с востока на запад, как со стороны финской, так и южно-балтийской. Это в Скандинавии не свои гаплотипы, все – мигранты с востока. Вот имеем – в Дании оба гаплотипа имеют 9-9, 14-14-15-15, то есть южно-балтийские. Оба – идентичные в 67-маркерном формате, то есть их общий предок жил в пределах последних двух столетий. Какие уж там Рюриковичи… Три эстонских гаплотипа – опять южно-балтийские, вовсе не финские. У всех трех четверка 14-14-15-15, нехарактерная для финских гаплотипов, но характерная для славянских. Общий предок жил в начале нашей эры, что обычно для N1c1.

Из 10 норвежских гаплотипов четыре – славянские, 9-9, 14-14-15-15, и еще два – продукты одношаговой мутации от них. То есть 60% славянских, южно-балтийских гаплотипов N1c1. Всего один гаплотип – финский, еще два – продукты палиндромных мутаций, которых у Рюриковичей нет.

Наконец, у шведов – треть славянских гаплотипов 9-9, 14-14-15-15; еще девять (в сумме – 16, три четверти от всех) – его мутированные производные; и пять гаплотипов (четверть от всех) – финские, 10-10, 13-13-14-14, которых у Рюриковичей нет. Такова цена высказываниям «ДНК-генеалога», историка В. Волкова, что «у Рюриковичей – шведские гаплотипы». Рюриковичи – либо носители гаплогруппы R1a, славяне, либо носители южно-балтийской, славянской ветви гаплогруппы N1c1.

Осталось разобраться еще с одной дезинформацией, опубликованной в упомянутой статье журнала Newsweek: «Наш поиск по крупнейшей онлайновой базе YSearch подтвердил его слова: среди найденных там нескольких десятков генетических родственников Рюриковичей 90% заявили, что их дальние предки жили в центре и на севере современной Финляндии, а оставшиеся 10% указали Швецию и Британию».

Откуда взялись эти «несколько десятков генетических родственников»? С этим оказалось просто. «Крупнейшая онлайновая база генетических родственников Рюриковичей», которую Newsweek постеснялся называть – это известный польский проект Анджея Байора. В нем – 341 гаплотип, из которых 262 – 67-маркерные. Дерево этих 262 гаплотипов приведено ниже.


Рис. 5. Дерево 67-маркерных гаплотипов 262 человек разных гаплогрупп, занесенных в польский проект «Рюриковичей» на основании гаплотипов «документальных Рюриковичей», сходства гаплотипов с гаплотипами «документальных Рюриковичей», личных заявлений тех, кто претендует на «Рюриковичей», и тех, у кого гаплотипы сходны с последними. Здесь представлены гаплотипы гаплогрупп N1c1, R1a, R1b, G2a, I1, I2, E1b, Q1b. Гаплотипы 11-ти князей, описанные выше, занимают маленькую веточку в верхней правой части дерева, с номерами от 1 до 11; уголок прямоугольника с надписью «Князья N1c1» направлен на номер 1, остальные десять гаплотипов группируются вокруг номера 1. Гаплотипы князей гаплогруппы R1a, приведенные на рис. 1 (Оболенский, Волконский, Пентекост, Шуйский и другие), группируются в нижней части правой боковой разбросанной ветви. Плотное длинное образование из почти двух сотен гаплотипов вверху и слева – гаплотипы гаплогруппы N1c1; оно, помимо упомянутых князей (отмеченных прямоугольником с надписью), включает самый разношерстный конгломерат ветвей гаплогруппы, включая и того самого Кубарева со своей «командой», на диаметрально противоположной стороне от упомянутых князей. Правая верхняя часть дерева не имеет мутации L1025- (к ним относятся и князья), середина левой стороны дерева имеет мутацию L1025+ (например, Шеховцовы Курско-Орловского происхождения, Чарторицкий, Белоусов; этой мутации вообще пока не замечено в Швеции, Норвегии, Дании, Англии). Объяснение этой и других мутаций приведено ниже на схеме субкладов гаплогруппы N. В частности, мутация L1025+ является дочерней по отношению к L550. Это, естественно, не означает, что «дочерняя» здесь – это потомки русских князей. Это означает, что как князья (наиболее вероятно относящиеся к субкладу L550+, L1025-), так и носители снипа L1025+ являются потомками общего предка субклада L550+. Иначе говоря, N1c1-L550 дал несколько «параллельных» ДНК-генеалогических линий – в одной оказались князья L550+, L1025-, в другой – носители L550+, L1025+.

Это дерево, да и весь польский проект Байора нуждается в пояснении. «Родственники Рюриковичей» – здесь все, кто в них решили записаться на основании семейных легенд или вообще без основания, на всякий случай, авось – княжеских кровей. А также гаплотипы тех, кто похожи на этих «родственников», так, тоже на всякий случай. Здесь же и гаплотипы князей, перечисленных выше, и гаплотипы, похожие на них. Дать определение слова «похожие» здесь невозможно, это на самом деле почти все, кто так решил. В общем, суть проекта А. Байора понятна – записать в «родственники Рюриковичей» всех, кто пожелает, и кто похож по гаплотипам на тех, кто пожелает, и пусть будет такая база данных, пусть с явным избытком. А потом когда-нибудь будем разбираться, когда появятся научные возможности.

Сейчас эти возможности появились, и что мы видим? А то, что в польском проекте была составлена полная сборная солянка, она же – щи из топора. Только топоров оказалось тоже много. Поскольку А. Байор не знал, кем на самом деле окажутся Рюриковичи, он проявил истинно либеральный подход. В итоге в «Рюриковичи» попали гаплотипы гаплогрупп N1c1, R1a, R1b, G2a, I1, I2, E1b, Q1b. Ясно, что каждый из них исключает другие, но «до кучи сгодится». Но журнал Newsweek, не моргнув глазом, взял эту кучу «на полном серьезе», всех назвав «генетическими родственниками Рюриковичей».

Что заявляют эти «генетические родственники», никому не должно быть интересно, пока не доказано, что они – Рюриковичи. Что до этого их слушать? Они и составили в основном развесистую клюкву в виде дерева гаплотипов, показанного на рис. 5. Разумеется, никакие это не «генетические родственники» в своем подавляющем большинстве. Журнал Newsweek в этом просто не разбирался. А поскольку русских, украинцев, белорусов из списка просто вычеркнули (а их там немало, как минимум 85 человек из 425, то есть 20%), а также многочисленных поляков и других славян, то без смеха этот пассаж – «90% заявили, что их дальние предки жили в центре и на севере современной Финляндии, а оставшиеся 10% указали Швецию и Британию» – читать просто нельзя. Вот так русский журнал Newsweek c «консультантами» делает русскую историю. И сало, само собой, русское едят.

Переходим к последней части нашего изложения, в которой производятся практически окончательные отнесения гаплотипов русских князей, описанных выше. Для этого нам необходимо разобраться в понятиях «снип» и «субклад». Снип, что есть калька с сокращения SNP (в английском языке это тоже называют snip) – это практически необратимая мутация в ДНК, которая в Y-хромосоме потом «автоматически» передается по наследству, переходя из Y-хромосомы ДНК отца в Y-хромосому сына. Последующие снипы дополнительно сопровождают ту же хромосому. В итоге у нас в Y-хромосоме есть миллионы снипов, многие снипы прошли весь эволюционный путь от общего предка человека и шимпанзе, и в настоящее время в изобилии находятся в ДНК как современного человека, так и современного шимпанзе.

Схема ниже показывает, какие дополнительные снипы набежали в Y-хромосоме человека со времени образования (путем соответствующей мутации) снипа М231, который и начал гаплогруппу N примерно 20 тысяч лет назад. Этот снип ознаменовал отделение гаплогруппы N от сводной, более древней гаплогруппы NO (которую образовал снип М214 примерно 45 тысяч лет назад), и так далее вниз по шкале времени.


Все вышестоящие снипы есть в нижестоящих субкладах, но не наоборот. Как видно, эти снипы образуют лесенку, или пирамиду. Так вот, снип L550, выделенный на схеме красным цветом, характерен для славян, имеющих шестерку 9-9, 14-14-15-15, и его имеют почти все, находящиеся в правой, более густой ветви на рис. 4. В этой же ветви находятся все 11 русских князей. У финнов в левой удаленной ветви (их там преобладающее количество) снипа L550 нет, и их типичная шестерка 10-10, 13-13-14-14. Эти факторы в совокупности подтверждают, что гаплотипы русских князей – не финские, не «норманские», не скандинавские. Это – южно-балтийские, славянские гаплотипы.

Но у норманофилов своя «логика». В базе данных, по которой построен рис. 4, группа русских князей записана как «скандинавские гаплотипы». Почему, откуда? Ответ – а потому что там и скандинавы есть. Но почему не наоборот, что те «скандинавы», напротив, славянского происхождения? Не дают ответа. А у большинства тех скандинавов известная шестерка имеет знакомый нам вид 9-9, 14-14-15-15. Славянская.

Так что прав был академик В.Л. Янин, специалист по археологии и этнографии, который писал: «Исходная область славянского заселения Псковского и Новгородского регионов находилась на территории славянской южной Балтики». Речь идет о северных регионах, где и сейчас самая высокая доля носителей гаплогруппы N1c1-L550 в Российской Федерации. Как водится, средства массовой информации и «историки» тут же обрадованно оживились, и стали писать, что эти территории исходно были «финскими», не желая обращать внимание, что в цитате из Янина дважды повторено слово «славянские».

Финнов совершенно напрасно пристегивают к истории северного региона России. Будем надеяться, что это искажение русской истории будет выправлено пересмотром этих ошибок, причем пересмотр будет проводиться при активном рассмотрении данных и выводов ДНК-генеалогии.

Ещё удручает, что норманофильская профанация продолжается. Опять передергивания, подтасовки, искажения. Одни выдают себя за «ДНК-генеалогов», с которыми они и близко не стояли, другие – дают безграмотные интерпретации. Хотя… пусть продолжают! Они, как та унтер-офицерская вдова, которая сама себя высекла. Пусть секут себя – нам веселее.

Анатолий А. Клёсов,
профессор химии и биохимии Московского и
Гарвардского университетов и АН СССР (в разные времена),
главный научный сотрудник


Пан Головатый
отправлено 02.03.13 18:02 # 2


Положили сайт по ссылке!


Goblin
отправлено 02.03.13 18:06 # 3


Кому: Пан Головатый, #2

> Положили сайт по ссылке!

камрад Цитата в помощь


porter2
отправлено 02.03.13 18:16 # 4


Всю статью разговор про происхождение Рюриковичей, а потом хуяк: "прав был академик В.Л. Янин, специалист по археологии и этнографии, который писал: «Исходная область славянского заселения Псковского и Новгородского регионов находилась на территории славянской южной Балтики». " А про Рюрика дорассказать?


Козябр
отправлено 02.03.13 18:25 # 5


Кому: porter2, #4

Я так понял Рюрики и были славянами-балтийцами, вот и весь сказ.


porter2
отправлено 02.03.13 18:28 # 6


Кому: Козябр, #5

ПВЛ нам говорит, что Рюрик был призван на княжение, а не вел свой народ как Моисей с юга Балтики


Beytix
отправлено 02.03.13 18:30 # 7


Позновательно...


Козябр
отправлено 02.03.13 18:30 # 8


Кому: porter2, #6

Он ждал в засаде пока балтийские моисеи своё отработают, и потом напрыгнул.


Козябр
отправлено 02.03.13 18:31 # 9


Кому: porter2, #6

ПВЛ - это что?


Ashotovich
отправлено 02.03.13 18:32 # 10


Статья, к сожалению, с большой долей вероятности - бред. Ибо за князем Оболенским (хотя князем он себя не зовет, князей нынче нет) пару лет назад и вправду носился некий господин, пытавшийся взять у него честичку слизизстой оболочки щеки, но тот его послал куда подальше. Тогда господин попытался через социальную сеть вкрасться в доверие к дочке оного Оболенского. Дочка, проявив политическую сознательность, господина также послала куда подальше. Тогда господин начал натурально хамить и был послан окончательно и бесповоротно. Так что материала Оболенского у исследователей так и не оказалось. А тут - вишь.


porter2
отправлено 02.03.13 18:33 # 11


Кому: Козябр, #9

Повесть Временных Лет


Бешеный прапор
отправлено 02.03.13 18:33 # 12


Знаем мы этих, у которых фамилии на "ич" заканчиваются. То Рюриковичи, то Рабиновичи.


porter2
отправлено 02.03.13 18:36 # 13


Кому: Бешеный прапор, #12

Немировичи, Якубовичи, а еще Ольгердовичи и Корибутовичи


Zx7R
отправлено 02.03.13 18:40 # 14


Кому: Бешеный прапор, #12

> Знаем мы этих, у которых фамилии на "ич" заканчиваются. То Рюриковичи, то Рабиновичи.

Даже в русские былины пробрались - Алёша Попович к примеру!


Добрый_Сибиряк
отправлено 02.03.13 18:41 # 15


Кому: porter2, #4

> А про Рюрика дорассказать?

А что рассказывать-то ?!!! Наш он.

Статья отличная.


porter2
отправлено 02.03.13 18:42 # 16


Кому: Zx7R, #14

Да и Добрыня - Никитич ведь!!!


porter2
отправлено 02.03.13 18:43 # 17


Кому: Добрый_Сибиряк, #15

> Наш он.
>

Это я и так знаю. А чьих наших?


Пан Головатый
отправлено 02.03.13 18:43 # 18


Кому: Zx7R, #14

> Попович

А нет ли здесь антисемитизму???
Попович - славянский/христианский налог фамилии Рабинович!!! Маскировался!!!


Zx7R
отправлено 02.03.13 18:46 # 19


Кому: porter2, #16

> Да и Добрыня - Никитич ведь!!!

Вот! Извели редкое животное - даже в красную книгу вписать не успели (хотя сдаётся мне что Горыныч поляком был, такой же вредный)


Пан Головатый
отправлено 02.03.13 18:47 # 20


Кому: Zx7R, #19

> хотя сдаётся мне что Горыныч поляком был,

Нет! Он отжигал по полной!


Очень толстый
отправлено 02.03.13 18:48 # 21


Объясните коротко. Кого царем к себе звать будем??? Предлагаю Ржевского. Его все знают.


Добрый_Сибиряк
отправлено 02.03.13 18:49 # 22


Кому: Ashotovich, #10

> Статья, к сожалению, с большой долей вероятности - бред...
> Так что материала Оболенского у исследователей так и не оказалось. А тут - вишь.

Ну-ну. А тут вот следующее говорят "Исследование, позволяющее разрешить загадку происхождения Рюрика генетическими методами одновременно начали в конце 2006 года Никита Максимов, представитель журнала «Русский Newsweek» и Анджей Байор, открывший при компании Family Tree DNA (Техас, США) научно-исследовательский проект «Rurikid Dynasty DNA Project». Более успешно начал свою деятельность "Русский Newsweek", который сумел убедить участвовать в исследовании двух потомков Владимира Мономаха: Дмитрия Шаховского (Париж, Франция) и Андрея Гагарина (Россия, Санкт-Петербург)[1]. В свою очередь А. Байор привлек к исследованию Якуба Пузыну (Польша) и Джона Пентекоста-Волконского (США), утверждавшего, что он является внебрачным сыном князя Бориса Дмитриевича Волконского, бежавшего во время большевистской революции во Францию (через Югославию), а затем в США.

В течение последующего времени через Русский "Newsweek" были протестированы другие потомки Рюрика (выполнены от 12 до 25 маркеров): Шаховский, Гагарин, Лобанов-Ростовский и Оболенский. Гагарин и Оболенский после испытаний Русского "Newsweek’а" вступили в «Rurikid Dynasty DNA Project», благодаря чему их гаплотипы был расширены до 67 маркёров. Затем в проекте стали участвовать Ржевский, Шуйский и Четвертинский. Благодаря помощи А.Журавлева-Сеславина в «Rurikid DynastyDNAProject» были привлечены князья Путятин, Хилков, Кропоткин, Вадбольский, Мышецкий и Волконский.

Относительно недавно совместными усилиями «RurikidDynastyDNAProject» и «RussianNobilityDNAProject», руководителями последнего являются Владимир Волков и Станислав Думин, были протестированы Массальский (Польша), Барятинский (Франция), Друцкий-Соколинский, а также Белосельский-Белозерский (Франция) и Карпов (Россия). И уже в момент завершения статьи через «RurikidDynastyDNAProject» был протестирован на 67 маркёров князь Лобанов-Ростовский. "


Добрый_Сибиряк
отправлено 02.03.13 18:50 # 23


Кому: porter2, #17

> Это я и так знаю. А чьих наших?

Славянских :)


Пан Головатый
отправлено 02.03.13 18:51 # 24


Кому: Добрый_Сибиряк, #23

> Славянских :)

Часть из них сейчас немцы.


Добрый_Сибиряк
отправлено 02.03.13 18:52 # 25


Кому: Очень толстый, #21

> Предлагаю Ржевского. Его все знают.

У нас уже был один Ржевский. Как отольет в гранит, так сразу нервный смех у всех :)


Добрый_Сибиряк
отправлено 02.03.13 18:52 # 26


Кому: Пан Головатый, #24

> Часть из них сейчас немцы.

Значит, тоже из наших :)


Собакевич
отправлено 02.03.13 18:56 # 27


Кому: Цитата, #1

> сожалению, далее на запад и юг от уральской группы языков лингвисты в своей безграничной мудрости постоянно вставляют в языки слово «финские», «финно-угорские», «финно-пермские», «финно-волжские», «прибалтийско-финские». Как мы ниже увидим, это не согласуется с картиной миграций народов, родов, гаплогрупп. Эти миграции шли разными группами – будущие финны отдельно, будущие [южные балты – отдельно. Они – не финны по происхождению, по генеалогии].

Генетик лингвистам раскрыл глаза.


Добрый_Сибиряк
отправлено 02.03.13 18:59 # 28


У него же статья про праславян - http://pereformat.ru/2013/02/proiskhozhdenie-slavyan/


Собакевич
отправлено 02.03.13 18:59 # 29


Кому: Очень толстый, #21

> Объясните коротко. Кого царем к себе звать будем??? Предлагаю Ржевского.

Рюрикович, кстати.

Ржевские

— дворянский род, происходящий от князей Смоленских. Князь Федор Федорович был удельным князем города Ржева и в 1315 г. был послан московским князем Юрием Даниловичем в Новгород для защиты его от великого князя тверского Михаила Ярославича; новгородцы выдали князя Федора великому князю тверскому, который лишил его удела. Потомки князя Федора не именовались князьями. Родион Федорович Р. убит в Куликовской битве (1380). Матвей Михайлович Р., сын боярский, ездил в Литву в свите великой княжны Елены Ивановны, невесты литовского великого князя Александра (1495). Матвей Иванович Р. был при Иоанне IV дьяком, потом наместником в Чернигове, Рыльске и Ряжске; в 1576 г. ездил послом в Крым. Елизар Никитич († в 1599 г.) был воеводой в Новгороде, потом думным дворянином; ездил в 1587 г. в Литву с поручением набирать сторонников кандидатуры царя Федора Иоанновича на польский престол. Иван Никитич († в 1611 г.) в 1601 г. ездил послом в Копенгаген; убит в одно время с Прокопием Ляпуновым. Григорий Никитич Р. был думным дворянином (в начале XVII в.), Иван Иванович Р. († в 1678 г.) — воеводой в Енисейске и Нежине, потом окольничим, как и сын его Алексей, управлявший приказом Большой Казны. Матвей Петрович Р. († в 1803 г.) был сенатором. Об Алексее Андреевиче Р. см. соотв. статью. Род Р. внесен в родословную книгу Воронежской, Костромской, Курской, Московской, Орловской, Рязанской, С.-Петербургской, Тамбовской и Тверской губерний (Гербовник, I, 37).

(с) Брокгауз и Ефрон


Zapravshik
отправлено 02.03.13 19:07 # 30


гаплотип r1a1 тоже с балтики http://s1127.beta.photobucket.com/user/ft-d/media/6I-ol.jpg.html


Zapravshik
отправлено 02.03.13 19:09 # 31


Кому: porter2, #6

> ПВЛ нам говорит, что Рюрик был призван на княжение, а не вел свой народ как Моисей с юга Балтики

Там написано пояша всю русь с собой


radioactive
отправлено 02.03.13 19:13 # 32


Объясните в двух словах для неспециалиста: кто такие согласно этой писанине Рюриковичи, чем это нам грозит и при чем тут евреи?


porter2
отправлено 02.03.13 19:14 # 33


Кому: Zapravshik, #31

И что бы это значило?


porter2
отправлено 02.03.13 19:15 # 34


Кому: radioactive, #32

> кто такие согласно этой писанине Рюриковичи

Не финны


Parkanoid
отправлено 02.03.13 19:20 # 35


> Но и эти данные не позволяют безоговорочно считать четверых «Рюриковичей» гаплогруппы R1a истинными Рюриковичами. Во-первых, на гаплотипах слово «Рюрик» не написано. Их предком, несомненно, был знатный воевода, может, его звали Рюрик, а может – нет.

Забавно. Получается можно только приблизительно определить, что предок жил во времена Рюрика. Если генеалогического древа семьи на 40 поколений назад нет - фиг что докажешь.


Zapravshik
отправлено 02.03.13 19:21 # 36


Кому: porter2, #33

> И что бы это значило?

О переселениях людей не только князя, в ПВЛ говорится, говорится даже, что новгородцы все варяжского рода находники.


porter2
отправлено 02.03.13 19:23 # 37


Кому: Zapravshik, #36

> О переселениях людей не только князя,

В смысле не только людей князя? Или не только князя?

Кому: Parkanoid, #35

> Если генеалогического древа семьи на 40 поколений назад нет - фиг что докажешь.

Можно сделать мазок!!!


Хоттабыч
отправлено 02.03.13 19:24 # 38


Кому: porter2, #13

Самуцевич, Самуцевич то забыли!!!


Собакевич
отправлено 02.03.13 19:27 # 39


Кому: Цитата, #1

> Но у норманофилов своя «логика». В базе данных, по которой построен рис. 4, группа русских князей записана как «скандинавские гаплотипы». Почему, откуда? Ответ – а потому что там и скандинавы есть. Но почему не наоборот, что те «скандинавы», напротив, славянского происхождения? Не дают ответа.

[тянет руку]

Потому что археологически зафиксировано проникновение скандинавов на Русь, а обратное нет.


Zapravshik
отправлено 02.03.13 19:27 # 40


Кому: porter2, #37

> В смысле не только людей князя? Или не только князя?

Не только князя и не только людей князя, но ещё о переселении всей Руси и варягов


Пан Головатый
отправлено 02.03.13 19:30 # 41


Кому: Zapravshik, #40

Понаехали тут! Новгород не резиновый! (с - возможно т.н. Вадим Храбрый)


SpiritOfTheNight
отправлено 02.03.13 19:36 # 42


Что то у меня от ДНК голова кругом пошла )


porter2
отправлено 02.03.13 19:37 # 43


Кому: Zapravshik, #40

> ещё о переселении всей Руси и варягов

это сильное утверждение. А как на это местные реагировали?


Zapravshik
отправлено 02.03.13 19:37 # 44


Кому: Пан Головатый, #41

> с - возможно т.н. Вадим Храбрый

Вадимку, как пишут, придумал составитель Никоновской летописи, чтобы показать с чего пошли новгородские крамолы, и что они необоснованны


Хоттабыч
отправлено 02.03.13 19:38 # 45


Кому: porter2, #16

Никитич таки ггазве не отчество???


Козябр
отправлено 02.03.13 19:39 # 46


Кому: Собакевич, #39

А скандинавы откуда вообще взялись? Тоже поди от наших, этих, протоарийцев?


Zapravshik
отправлено 02.03.13 19:40 # 47


Кому: porter2, #43

> А как на это местные реагировали?

дань даяху Варягомъ


porter2
отправлено 02.03.13 19:42 # 48


Кому: Хоттабыч, #45

Тогда фамилий не было


porter2
отправлено 02.03.13 19:46 # 49


Кому: Zapravshik, #47

Дык вроде их того, выгнали? А Рюрика потом?


Ded Hunhuz
отправлено 02.03.13 19:49 # 50


Кому: Собакевич, #39

> > Потому что археологически зафиксировано проникновение скандинавов на Русь, а обратное нет.

А что там среди этой вот деревенщины в Скандинавии делать?


Zapravshik
отправлено 02.03.13 19:51 # 51


Кому: porter2, #49

> Дык вроде их того, выгнали? А Рюрика потом?

Ну они опять пришли, они и после Рюрика приходили, ещё в 10 веке при Владимире приходит некий Рогволд из-за моря и занимет Полоцк.


Пан Головатый
отправлено 02.03.13 19:51 # 52


Кому: porter2, #49

> Дык вроде их того, выгнали? А Рюрика потом?

Новгородцы регулярно пытались кого-то выгонять, но в итоге несогласных резали.


Пан Головатый
отправлено 02.03.13 19:52 # 53


Кому: Ded Hunhuz, #50

> А что там среди этой вот деревенщины в Скандинавии делать?

Если ты о финнах, то да, деревенщина.


Zapravshik
отправлено 02.03.13 19:56 # 54


Кому: radioactive, #32

> при чем тут евреи?

А ты взгляни как новгородцы выглядели http://ttolk.ru/wp-content/uploads/2011/03/12.jpg


Ромыч
отправлено 02.03.13 19:57 # 55


Вот интересно, какая-нибудь из скандинавских саг (а они очень дотошные) рассказывает о призвании ихнего Хререка править Гардарикой? Блин, драку из-за лошади распишут во всех деталях, а тут такое эпохальное событие пропустили! Да и если верить переводу Лихачева "Повести временных лет", то там варяги-русь конкретно противопоставлены скандинавам. Короче, всю эту историю про Рюрика-шведа придумал (Черчилль в 18 году) швед Юхан в 16 веке.


Пан Головатый
отправлено 02.03.13 20:05 # 56


Кому: Ромыч, #55

> рассказывает о призвании ихнего Хререка править Гардарикой?

Его "Гардарикой" никто править не звал. "Гардарика" на тот момент не была цельным политическим образованием. Города в обывательском понимании можно было посчитать на пальцах рук.


Ashotovich
отправлено 02.03.13 20:07 # 57


Кому: Добрый_Сибиряк, #22


>Ну-ну. А тут вот следующее говорят "Исследование, позволяющее разрешить загадку происхождения Рюрика генетическими методами одновременно начали в конце 2006 года Никита Максимов, представитель журнала «Русский Newsweek» и Анджей Байор, открывший при компании Family Tree DNA (Техас, США) научно-исследовательский проект «Rurikid Dynasty DNA Project». Более успешно начал свою деятельность "Русский Newsweek", который сумел убедить участвовать в исследовании двух потомков Владимира Мономаха: Дмитрия Шаховского (Париж, Франция) и Андрея Гагарина (Россия, Санкт-Петербург)[1]. В свою очередь А. Байор привлек к исследованию Якуба Пузыну (Польша) и Джона Пентекоста-Волконского (США), утверждавшего, что он является внебрачным сыном князя Бориса Дмитриевича Волконского, бежавшего во время большевистской революции во Францию (через Югославию), а затем в США.

Ну-ну. Теперь буду точно знать, что верить следует демократическим журналистам, а не непосредственно участникам событий.


Ded Hunhuz
отправлено 02.03.13 20:11 # 58


Кому: Пан Головатый, #53

> > > А что там среди этой вот деревенщины в Скандинавии делать?
>
> Если ты о финнах, то да, деревенщина.

Да во времена Рюрика и в ШВеции было также грустно. Варяги оттуда толпами стремились наняться в охрану Византийскому базилевсу или пограбить Сицилию, Рим и Париж! Туристы


Собакевич
отправлено 02.03.13 20:11 # 59


Кому: Козябр, #46

> А скандинавы откуда вообще взялись?

Из Средней Европы, судя по всему.

> Тоже поди от наших, этих, протоарийцев?

Я не знаю, кто такие ваши протоарийцы.


Ромыч
отправлено 02.03.13 20:13 # 60


Кому: Пан Головатый, #56

> Его "Гардарикой" никто править не звал. "Гардарика" на тот момент не была цельным политическим образованием. Города в обывательском понимании можно было посчитать на пальцах рук.

Эээ... Хорошо, допустим. Тогда править Хольмгардом? Интересно, есть в сагах что-нибудь об этом?


Пан Головатый
отправлено 02.03.13 20:14 # 61


Кому: Ded Hunhuz, #58

> Варяги оттуда толпами стремились наняться в охрану Византийскому базилевсу или пограбить Сицилию, Рим и Париж!

Ну всё же они со своим инструментом плавали: не гастарбайтеры какие-нибудь, а специалисты приличного уровня.


Собакевич
отправлено 02.03.13 20:15 # 62


Кому: Ромыч, #55

> Короче, всю эту историю про Рюрика-шведа придумал (Черчилль в 18 году) швед Юхан в 16 веке.

Что бы без тебя все ученые делали.


Собакевич
отправлено 02.03.13 20:17 # 63


Кому: Ромыч, #60

> Тогда править Хольмгардом? Интересно, есть в сагах что-нибудь об этом?

Саги - не основной источник по истории Древней Руси.


Zapravshik
отправлено 02.03.13 20:23 # 64


Кому: Собакевич, #39

> Потому что археологически зафиксировано проникновение скандинавов на Русь, а обратное нет.

На Руси в основном франкские (оружие) или общебалтийские(погребения) находки объявленные скандинавскими как скрамасаксы например, http://alex-oleyni.livejournal.com/20516.html?thread=3364

В то время все подражали франкам, а не скандинавам


Ded Hunhuz
отправлено 02.03.13 20:24 # 65


Кому: Пан Головатый, #61

> Ну всё же они со своим инструментом плавали: не гастарбайтеры какие-нибудь, а специалисты приличного уровня.

Да кто же голытьбу без струмента и навыков на работу возьмёт? Вот и приходилось демонстрировать боевые качества, штурмуя ворота Царьграда!


Добрый_Сибиряк
отправлено 02.03.13 20:24 # 66


Кому: Ashotovich, #57

> Ну-ну. Теперь буду точно знать, что верить следует демократическим журналистам, а не непосредственно участникам событий.

Ты прямо у Оболенского спрашивал ?! И к слову, достаточно волоса для анализа.


Ded Hunhuz
отправлено 02.03.13 20:25 # 67


Кому: Собакевич, #62

А что это за зверь за такой Юхан из 16 века? Случаем не по фамилии Зудерман?


Пан Головатый
отправлено 02.03.13 20:25 # 68


Кому: Ромыч, #60

> Эээ... Хорошо, допустим.

Это исторический факт без допусков или припусков.

> Тогда править Хольмгардом?

Я бы назвал это возглавлением местного объединения с центром в Новгороде.
> Интересно, есть в сагах что-нибудь об этом?

В сагах события описываются, из замеченного тобой выше, не по значимости. Более того: вся дискуссия проистекает из вакуума информации от устных преданий славянского населения и крупиц информации в письменных источниках.


Ded Hunhuz
отправлено 02.03.13 20:26 # 69


Кому: Собакевич, #59

> Я не знаю, кто такие ваши протоарийцы.

[Достает пыльный гроссбух Шилова] Это же протоукры!


Пан Головатый
отправлено 02.03.13 20:28 # 70


Кому: Ded Hunhuz, #65

> Вот и приходилось демонстрировать боевые качества, штурмуя ворота Царьграда!

Скорее разоряя окрестности, ближние фемы.


Ромыч
отправлено 02.03.13 20:31 # 71


Кому: Собакевич, #63

> Саги - не основной источник по истории Древней Руси.

Зато это возможность взглянуть на вопрос с другой стороны, скандинавской. А насчет достоверности саг... Раз уж раскопали поселения Эрика Рыжего в Гренландии и Лейфа на Лабрадоре, руководствуясь сагами, наверное хотя бы отчасти им можно доверять.


Asya
отправлено 02.03.13 20:33 # 72


Потрясающе интересный материал сам по себе, большое спасибо за публикацию. Даже безотносительно этого карнавала с Рюриковичами


Ded Hunhuz
отправлено 02.03.13 20:33 # 73


Кому: Пан Головатый, #70

> Вот и приходилось демонстрировать боевые качества, штурмуя ворота Царьграда!
>
> Скорее разоряя окрестности, ближние фемы.

ТАк ведь товар лицом надо показывать! Интересеные в прежние времена были обычаи при трудоустройстве! Хипстеров на работу тогда не брали! Разорил 12 поселков, изнасиловал 100 баб - добро пожаловать в личные телохранители базилевса! А вот ежели долго и нудно просил пустить в город - точно румын! И ну его на хер!


Пан Головатый
отправлено 02.03.13 20:34 # 74


Кому: Zapravshik, #64

> а Руси в основном франкские (оружие) или общебалтийские(погребения) находки объявленные скандинавскими как скрамасаксы наприме

Разный химсостав стали.


astepin
отправлено 02.03.13 20:34 # 75


Кому: Добрый_Сибиряк, #15

> А что рассказывать-то ?!!! Наш он.

Да кто бы ни был на новой Родине проявил себя молодцом!


Ded Hunhuz
отправлено 02.03.13 20:34 # 76


Кому: Asya, #72

> Потрясающе интересный материал сам по себе, большое спасибо за публикацию. Даже безотносительно этого карнавала с Рюриковичами

Клёсов - он такой! Азартный! Но в науке без азарта нельзя!


Пан Головатый
отправлено 02.03.13 20:37 # 77


Кому: Ромыч, #71

> Раз уж раскопали поселения Эрика Рыжего в Гренландии и Лейфа на Лабрадоре

Старая Ладога.


Ded Hunhuz
отправлено 02.03.13 20:39 # 78


Кому: Ромыч, #71

> Раз уж раскопали поселения Эрика Рыжего в Гренландии и Лейфа на Лабрадоре [Путина],

Извини!


Собакевич
отправлено 02.03.13 20:40 # 79


Кому: Zapravshik, #64

> На Руси в основном франкские (оружие) или общебалтийские(погребения) находки объявленные скандинавскими как скрамасаксы например,

Спасибо. Меня, правда, ЖЖ как источник знаний о средневековой истории Руси и Скандинавии не интересует.


Собакевич
отправлено 02.03.13 20:42 # 80


Кому: Ded Hunhuz, #67

> А что это за зверь за такой Юхан из 16 века? Случаем не по фамилии Зудерман?

Я сам заинтригован.


Zapravshik
отправлено 02.03.13 20:44 # 81


Кому: Пан Головатый, #74

> Разный химсостав стали.

Сомневаюсь, что кто-то проводил такое сравнение скандинавских и русских находок, если тебе известно о таком анализе до буду признателен за подробности.


Собакевич
отправлено 02.03.13 20:45 # 82


Кому: Ded Hunhuz, #69

> [Достает пыльный гроссбух Шилова] Это же протоукры!

У меня была его книжка в серии "Эврика" :)


Пан Головатый
отправлено 02.03.13 20:45 # 83


Кому: Собакевич, #80

Камрад, а вот с точки зрения археологии, с какого времени существует постоянное славянское городище, которое можно напрямую отождествить с летописным Новгородом?


dnepr
отправлено 02.03.13 20:45 # 84


Варяги ведь не национальность? Может, это какое-то военное ремесло, типа, казачества. "И призвали из казаков, которые кубанские, атамана Жбурляя, мол, правь нами".


Ромыч
отправлено 02.03.13 20:46 # 85


Кому: Собакевич, #80

> Кому: Ded Hunhuz, #67
>
> > А что это за зверь за такой Юхан из 16 века? Случаем не по фамилии Зудерман?
>
> Я сам заинтригован.

Король Юхан III, бокс по переписке с Иваном Грозным.


Ded Hunhuz
отправлено 02.03.13 20:48 # 86


Кому: Собакевич, #80

ЕМНИП Крижанич писал, что норманнская теория - это результат домыслов шведа Петра Петрея! (интересно, почему его не звали Петерсон?).


Собакевич
отправлено 02.03.13 20:48 # 87


Кому: Ромыч, #71

> руководствуясь сагами, наверное хотя бы отчасти им можно доверять.

То есть ты не понимаешь, что в сагах не обязательно должны быть отражены все исторические события?


Zapravshik
отправлено 02.03.13 20:49 # 88


Кому: Собакевич, #79

> Спасибо. Меня, правда, ЖЖ как источник знаний

Это не источник, ну да ладно.


Ded Hunhuz
отправлено 02.03.13 20:50 # 89


Кому: Ромыч, #85

> Король Юхан III, бокс по переписке с Иваном Грозным.

ААА! Ну тогда, если верить Крижаничу - фамилия этого Юхана была Зудерман!


Ded Hunhuz
отправлено 02.03.13 20:54 # 90


Кому: Собакевич, #82

> У меня была его книжка в серии "Эврика" :)

Да я вот лет 15 назад купил его книгу "Прародина Ариев". Книга очень даже толковая. В процессе написания автор периодически ужасался укрским теориям и прочему постсовесткому бреду. Автор твердо стоял на мнении, что родина ариев - Северное Причерноморье. Но факты изложены довольно объективно!

Самое смешное, что профессор истории из ВГУ Григорис Веллас тоже был свято уверен, что родина его народа в Северном Причерноморье. Но он все время ссылался на псалии. Хотя какие к черту псалии в Греции - там вырастить коня - проблема.


Ashotovich
отправлено 02.03.13 20:58 # 91


Кому: Добрый_Сибиряк, #66

От него и знаю - иначе бы не говорил.


Ded Hunhuz
отправлено 02.03.13 21:00 # 92


Кому: Ashotovich, #91

Камрад! Оболенских нельзя относить к вымирающим родам!


Ashotovich
отправлено 02.03.13 21:05 # 93


Кому: Добрый_Сибиряк, #66

Кстати, вычитал - оказывается еще один в Самаре есть. Хм. Возможно, до него удалось докопаться ученым, кто знает. Но какие люди проводили исследование - караул.


Grizlik
отправлено 02.03.13 21:07 # 94


Кому: radioactive, #32

Евреи везде при чём (с)


Ромыч
отправлено 02.03.13 21:08 # 95


Кому: Собакевич, #87

> Кому: Ромыч, #71
>
> > руководствуясь сагами, наверное хотя бы отчасти им можно доверять.
>
> То есть ты не понимаешь, что в сагах не обязательно должны быть отражены все исторические события?

Прекрасно понимаю, что событие событию рознь. И призвание местного вождя править прямо скажем, не соседним племенем, а малость подале и поболе - серьезное событие, достойное быть отмеченным. Если таковое событие имело место быть, конечно. А за примерами ходить недалеко - вон, саги об Олафе Трюгвассоне и Харальде Хардраде описывают их пребывание на Руси. Хотя они там уж точно не князьями были.
Впрочем, я не цепляюсь за эти саги. Для меня это просто еще один кусочек из большой мозаики.


Ю.Цезий
отправлено 02.03.13 21:12 # 96


Не по теме.
Камрады, это только у меня страница вылезает за пределы экрана?
Длинных ссылок не нашел. Козни норманофилов?


Собакевич
отправлено 02.03.13 21:23 # 97


Кому: Пан Головатый, #83

> Камрад, а вот с точки зрения археологии, с какого времени существует постоянное славянское городище, которое можно напрямую отождествить с летописным Новгородом?

С ходу затрудняюсь ответить, надо специальные книжки смотреть. В районе истока Волхова славянские древности с VIII в. фиксируются. А в самом Новгороде же не все можно копать.


Собакевич
отправлено 02.03.13 21:26 # 98


Кому: Ded Hunhuz, #90

Давай, постараюсь в ближайшее время специально ответить.


Собакевич
отправлено 02.03.13 21:35 # 99


Кому: Ю.Цезий, #96

> Камрады, это только у меня страница вылезает за пределы экрана?

Нет.


УниверСол
отправлено 02.03.13 21:40 # 100


Кому: Ю.Цезий, #96

> Камрады, это только у меня страница вылезает за пределы экрана?

Вылезает, родимая, вылезает. Похоже, у браузеров от статьи тоже крышу снесло.

IE, Chrome.



cтраницы: 1 | 2 | 3 всего: 231


разделы

Главная страница

Tynu40k Goblina

Синий Фил

Опергеймер

Светосила

За бугром

English

Победа!

интересное

Новости

Заметки

Картинки

Видео

Переводы

Комментарии

Поисковые запросы

гоблин

Гоблин в Facebook

Гоблин в Twitter

Гоблин в Google+

Гоблин в Instagram

Гоблин на YouTube

Гоблин в ivi

Видео в iTunes Store

Аудио в iTunes Store

tynu40k

Новости в RSS

Новости в Facebook

Новости в Twitter

Новости в Google+

Новости в ЖЖ

Группа в Контакте

реклама

Разработка сайтов Megagroup.ru

Реклама на сайте


Goblin EnterTorMent © | заслать письмо | цурюк